View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13515_low_4 (Length: 238)
Name: NF13515_low_4
Description: NF13515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13515_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 16 - 226
Target Start/End: Complemental strand, 30552685 - 30552475
Alignment:
| Q |
16 |
cagaaaatataactgagctacataaatatttacaaaatagattctttagtaatttcaaaagtatattatacaagactaaacaatcttgattaactaatct |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
30552685 |
cagaaaatataactgagctacataaatatttacaaaatagattctttagtaatttcaaaagtatattatacaaaacta-----tcttgattaactaatct |
30552591 |
T |
 |
| Q |
116 |
tttgatactcttgcaggttttggatctggcttttttccatatttttcatattccttagcgcacacggtatgacatttt-----ttaaacttgtcacttgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
30552590 |
tttgatactcttgcaggttttggatctggcttttttccatatttttcatattccttagcgcacacggtatgtcattttacatattaaacttgtcacttgt |
30552491 |
T |
 |
| Q |
211 |
aactaatcatgtccct |
226 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
30552490 |
aactaatcatgtccct |
30552475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University