View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13516_high_14 (Length: 249)

Name: NF13516_high_14
Description: NF13516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13516_high_14
NF13516_high_14
[»] chr1 (3 HSPs)
chr1 (48-138)||(35379040-35379130)
chr1 (154-228)||(35378938-35379012)
chr1 (74-138)||(30623223-30623287)
[»] chr2 (1 HSPs)
chr2 (67-138)||(31858243-31858314)
[»] chr5 (1 HSPs)
chr5 (65-138)||(36565175-36565248)
[»] scaffold0004 (1 HSPs)
scaffold0004 (67-132)||(372043-372108)
[»] chr7 (1 HSPs)
chr7 (97-138)||(46864945-46864986)
[»] chr4 (1 HSPs)
chr4 (69-138)||(40084076-40084145)


Alignment Details
Target: chr1 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 48 - 138
Target Start/End: Complemental strand, 35379130 - 35379040
Alignment:
Q  48 ctcatatcattgtttttacggatgtggatcctctctagcctttttagttcagccatctctcctttttcaatccaacggttgattgaaacat 138  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||    
T  35379130 ctcatatcattgtttttacggatgtggatcctctctagcctttttagttcggccatctctcctttttcaatccaactgttgattgaaacat 35379040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 154 - 228
Target Start/End: Complemental strand, 35379012 - 35378938
Alignment:
Q  154 ttagaaaatgattaggtaaaggcaggatagacagcatgagaggatccaaacccttgtttttaccatgttatatat 228  Q
    |||| |||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35379012 ttagtaaatgattaggttaaggtaggatagacagcatgagaggatccaaacccttgtttttaccatgttatatat 35378938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 74 - 138
Target Start/End: Original strand, 30623223 - 30623287
Alignment:
Q  74 gatcctctctagcctttttagttcagccatctctcctttttcaatccaacggttgattgaaacat 138  Q
    ||||| ||||||||||||| ||||||||||||||||||||| ||| |||  ||||||||| ||||    
T  30623223 gatccactctagcctttttggttcagccatctctccttttttaattcaatagttgattgatacat 30623287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 67 - 138
Target Start/End: Original strand, 31858243 - 31858314
Alignment:
Q  67 ggatgtggatcctctctagcctttttagttcagccatctctcctttttcaatccaacggttgattgaaacat 138  Q
    |||||||||||||||| ||||||||| |||||||| ||||||||||||||||| |||  |||||||| ||||    
T  31858243 ggatgtggatcctctccagcctttttggttcagccttctctcctttttcaatctaacaattgattgatacat 31858314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 65 - 138
Target Start/End: Original strand, 36565175 - 36565248
Alignment:
Q  65 acggatgtggatcctctctagcctttttagttcagccatctctcctttttcaatccaacggttgattgaaacat 138  Q
    |||||| |||||||||||  ||| |||| |||||||||||||||||||||||||  || |||||||||| ||||    
T  36565175 acggatttggatcctctcctgcccttttggttcagccatctctcctttttcaatttaatggttgattgatacat 36565248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 67 - 132
Target Start/End: Complemental strand, 372108 - 372043
Alignment:
Q  67 ggatgtggatcctctctagcctttttagttcagccatctctcctttttcaatccaacggttgattg 132  Q
    |||| ||||||||||||||| ||||| || |||||  |||||||||||  ||||||||||||||||    
T  372108 ggatttggatcctctctagcattttttgtgcagccccctctccttttttgatccaacggttgattg 372043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 97 - 138
Target Start/End: Complemental strand, 46864986 - 46864945
Alignment:
Q  97 cagccatctctcctttttcaatccaacggttgattgaaacat 138  Q
    |||||||||||| |||| ||||||||||||||||||| ||||    
T  46864986 cagccatctctctttttccaatccaacggttgattgatacat 46864945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 69 - 138
Target Start/End: Original strand, 40084076 - 40084145
Alignment:
Q  69 atgtggatcctctctagcctttttagttcagccatctctcctttttcaatccaacggttgattgaaacat 138  Q
    |||||||| |||||  ||| |||| ||||| |||| |||| ||||||||| |||||||||||||| ||||    
T  40084076 atgtggattctctccggcccttttggttcaaccatatctcatttttcaattcaacggttgattgatacat 40084145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University