View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13516_high_16 (Length: 241)
Name: NF13516_high_16
Description: NF13516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13516_high_16 |
 |  |
|
| [»] scaffold0188 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 240
Target Start/End: Original strand, 13636619 - 13636843
Alignment:
| Q |
16 |
gagaagaccattgatatgccacttgatagtgatgtttttgatgttccttctggttataatgctccccaacaggtannnnnnnacttaccctttatttctt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13636619 |
gagaagaccattgatatgccacttgatagtgatgtttttgatgttccttctggttataatgctccccaacaggtatttttctacttaccctttatttctt |
13636718 |
T |
 |
| Q |
116 |
tctttctttgatgctaattttgtattgaatacatccaagaaagatgtgatacaagtttttaaattgctcaagatattgcatgtttttctgtttgtaacta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13636719 |
tctttctttgatgctaattttgtattgaatacatccaagaaagatgtgatataagtttttaaattgctcaagatattgcatgtttttctgtttgtaacta |
13636818 |
T |
 |
| Q |
216 |
tgttattgatactaggtatacccag |
240 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
13636819 |
tgttattgatacgaggtatacccag |
13636843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 29 - 89
Target Start/End: Complemental strand, 50981676 - 50981616
Alignment:
| Q |
29 |
atatgccacttgatagtgatgtttttgatgttccttctggttataatgctccccaacaggt |
89 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50981676 |
atatgtcacttgatagtgatgtttttgctgttccttctggttataatgctccccaacaggt |
50981616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 16 - 90
Target Start/End: Original strand, 8291 - 8365
Alignment:
| Q |
16 |
gagaagaccattgatatgccacttgatagtgatgtttttgatgttccttctggttataatgctccccaacaggta |
90 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||| ||||| |||||||||||||||| ||||||||| |
|
|
| T |
8291 |
gagaagagcattgatatgccacttgatagcgatgtttttagggttccacctggttataatgctcctcaacaggta |
8365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University