View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13516_high_9 (Length: 362)
Name: NF13516_high_9
Description: NF13516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13516_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 20 - 352
Target Start/End: Original strand, 41443289 - 41443621
Alignment:
| Q |
20 |
atcttgtcatgaatactagcacctctgtactgtacatatcatattccagctaatatattcaaaaccaagcttctcttaacatttctaggtgagattgttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41443289 |
atcttgtcatgaatactagcacctctgtactgtacatatcatattccagctaatatattcaaaaccaagcttctcttaacatttctaggtgagattgttg |
41443388 |
T |
|
| Q |
120 |
atgttcagcaattaatatatattttgagctatgtagcattgacacttcacataaaaggctatccgacatgtggttactttcatcttttccattttctaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41443389 |
atgttcagcaattaatatatattttgagctatgtagcatcgacacttcacataaaaggctatccgacatgtggttactttcatcttttccattttctaat |
41443488 |
T |
|
| Q |
220 |
attatttgtgtctgtccgtgtcatcgatgcttcctaggttttgagttctgtcaagtagctggggtttgtaggtacttttgtatcattgctatggttagct |
319 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41443489 |
attatttgtgtccgtccgtgtcatcgatgcttcctaggttttgagttctgtcaagtagctggggtttgtaggtacttttgtatcattgctatggttagct |
41443588 |
T |
|
| Q |
320 |
catttttgttagtgtctgcgttgggatgatgtc |
352 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| |
|
|
| T |
41443589 |
catttttgttagtgtctgtgttggggtgatgtc |
41443621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University