View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13517_low_4 (Length: 270)
Name: NF13517_low_4
Description: NF13517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13517_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 24 - 159
Target Start/End: Original strand, 48570301 - 48570436
Alignment:
| Q |
24 |
atataaaaacaaaattaatagcaaacattatcacttgtggtgataggctgtgaatatcacatgatatcgatttaagtgcttccatatgagtcgaagaatc |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48570301 |
atataaaaacaaaattaatagcaaacattatcacttgtggtgagaggctgtgaatatcacatgatatcgatttaagtgcttccatatgagtcgaagaatc |
48570400 |
T |
 |
| Q |
124 |
taacttaatgatatcgatttattccaacaaagtagc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
48570401 |
taacttaatgatatcgatttattccaacaaagtagc |
48570436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 194 - 251
Target Start/End: Original strand, 48570471 - 48570528
Alignment:
| Q |
194 |
ggtgaagtactcggaaggaaatggtagaaatggccataatccataacggaatgataag |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48570471 |
ggtgaagtactcggaaggaaatggtagaaatggccataatccataacggaatgataag |
48570528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University