View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13518_low_19 (Length: 226)
Name: NF13518_low_19
Description: NF13518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13518_low_19 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 107 - 208
Target Start/End: Complemental strand, 31026403 - 31026300
Alignment:
| Q |
107 |
ctcacatcttatattactttggcatatttaaaatatcat--gtgaggtttcagtgttaaaactaattaaaccatcatctaaattgtaagtttataattgg |
204 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31026403 |
ctcacatcttatattactttcgcatatttaaaatatcatatgtgaggttttagtgttaaaactaattaaagcatcatctaaattgtaagtttataattgg |
31026304 |
T |
|
| Q |
205 |
cagt |
208 |
Q |
| |
|
|||| |
|
|
| T |
31026303 |
cagt |
31026300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University