View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351R-Insertion-15 (Length: 324)
Name: NF1351R-Insertion-15
Description: NF1351R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351R-Insertion-15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 9 - 317
Target Start/End: Complemental strand, 14597492 - 14597184
Alignment:
| Q |
9 |
gatttgaccctccctcaggtgattgggacacaaaagatcctaaacatgaatgtacggatgaagtctgtgaaactacaccggccttgaatgccagtgagtt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14597492 |
gatttgaccctccctcaggtgattgggacacaaaagatcctaaacatgaatgtacggatgaagtctgtgaaactacaccggccttgaatgccagtgagtt |
14597393 |
T |
|
| Q |
109 |
tgatcaagatttagattcaaacttgttgcccaagcgattcggtaattcatccatgttggctgatagcataccagtcgctgagttccaaggtcgccctctt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14597392 |
tgatcaagatttagattcaaacttgttgcccaagcgatttggtaattcatccatgttggctgatagcataccagtcgctgagttccaaggtcgccctctt |
14597293 |
T |
|
| Q |
209 |
gcagatcatcctaacgtcaggtatggacgtccaggaggtgttcttaggaaacctcgtgaaccactcgatgctcctacagtagcagaatctgtgtctgtca |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14597292 |
gcagatcatcctaacgtcaggtatggacgtccaggaggtgttcttaggaaacctcgtgaaccactcgatgctcctacagtagcagaatctgtgtctgtca |
14597193 |
T |
|
| Q |
309 |
tttcttgtt |
317 |
Q |
| |
|
||||||||| |
|
|
| T |
14597192 |
tttcttgtt |
14597184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University