View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1351R-Insertion-20 (Length: 152)

Name: NF1351R-Insertion-20
Description: NF1351R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1351R-Insertion-20
NF1351R-Insertion-20
[»] chr2 (1 HSPs)
chr2 (9-152)||(10666157-10666300)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 5e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 9 - 152
Target Start/End: Original strand, 10666157 - 10666300
Alignment:
9 ttattcagcagatctagttttgctgatttattgctattgaattgttattgcaattgaattttatcatctaatttgtatgtcaatttttgtgtgattttga 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10666157 ttattcagcagatctagttttgctgatttattgctattgaattgttattgcaattgaattttatcatctaatttgtatgtcaatttttgtgtgattttga 10666256  T
109 ttttggtataaaattgtagcatgcagcagtatttagcttagacc 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
10666257 ttttggtataaaattgtagcatgcagcagtatttagcttagacc 10666300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University