View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351R-Insertion-20 (Length: 152)
Name: NF1351R-Insertion-20
Description: NF1351R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351R-Insertion-20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 5e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 5e-76
Query Start/End: Original strand, 9 - 152
Target Start/End: Original strand, 10666157 - 10666300
Alignment:
| Q |
9 |
ttattcagcagatctagttttgctgatttattgctattgaattgttattgcaattgaattttatcatctaatttgtatgtcaatttttgtgtgattttga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10666157 |
ttattcagcagatctagttttgctgatttattgctattgaattgttattgcaattgaattttatcatctaatttgtatgtcaatttttgtgtgattttga |
10666256 |
T |
 |
| Q |
109 |
ttttggtataaaattgtagcatgcagcagtatttagcttagacc |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10666257 |
ttttggtataaaattgtagcatgcagcagtatttagcttagacc |
10666300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University