View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351R-Insertion-21 (Length: 96)
Name: NF1351R-Insertion-21
Description: NF1351R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351R-Insertion-21 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 1e-41; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 7 - 96
Target Start/End: Complemental strand, 37796371 - 37796282
Alignment:
| Q |
7 |
cagcatatgcaatctgcacaaacaccataacaatgactggttttagtccttgcaatgagttacatactcccttcatcttcacgatatgta |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37796371 |
cagcatatgcaatctgcacaaacaccataacaatgactggttttagtccttgcaatgagttacatacttccttcatcttcacgatatgta |
37796282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000002
Query Start/End: Original strand, 7 - 87
Target Start/End: Complemental strand, 37806411 - 37806331
Alignment:
| Q |
7 |
cagcatatgcaatctgcacaaacaccataacaatgactggttttagtccttgcaatgagttacatactcccttcatcttca |
87 |
Q |
| |
|
|||||||||||||||||||||||| ||| | |||| |||||||||| |||||||||| || |||| || |||||||||| |
|
|
| T |
37806411 |
cagcatatgcaatctgcacaaacaacattaggatgattggttttagtgcttgcaatgaattgtatacccctttcatcttca |
37806331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 14 - 88
Target Start/End: Complemental strand, 37785722 - 37785648
Alignment:
| Q |
14 |
tgcaatctgcacaaacaccataacaatgactggttttagtccttgcaatgagttacatactcccttcatcttcac |
88 |
Q |
| |
|
||||||||||||||||| ||| | || |||||||||| ||||| |||||| |||| || |||||||||||||| |
|
|
| T |
37785722 |
tgcaatctgcacaaacaacattaggatcactggttttactccttccaatgaattacctatccccttcatcttcac |
37785648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University