View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351_high_39 (Length: 251)
Name: NF1351_high_39
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351_high_39 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 135 - 251
Target Start/End: Original strand, 53458943 - 53459059
Alignment:
| Q |
135 |
ttgctatgcaaatgtgtgcagtcaaaaataattttcttactattagtgtattgcatattatattattactttacatatgtttgttgcaaaaataggaaat |
234 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53458943 |
ttgctatgcaaaggtgtgcagtcaaaaataattttcttactattagtgtattgcatattatattattactttacatatgtttgttgcaaaaataggaaat |
53459042 |
T |
 |
| Q |
235 |
gtaagagaattatgaac |
251 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
53459043 |
gtaagagaattatgaac |
53459059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 30 - 142
Target Start/End: Original strand, 53458793 - 53458905
Alignment:
| Q |
30 |
tttgttgtaagatcaaatggttcaaagatcagcgaggatgaaatcaagcaatacatatcacaacaggttctctttaatctttaccaaattagtagattaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53458793 |
tttgttgtaagatcaaatggttcaaagatcagcgaggatgaaatcaagcaatacatatcgcaacaggttctctttaatctttaccaaattagtagattaa |
53458892 |
T |
 |
| Q |
130 |
ttttcttgctatg |
142 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
53458893 |
ttttcttgttatg |
53458905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University