View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351_high_42 (Length: 245)
Name: NF1351_high_42
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351_high_42 |
 |  |
|
| [»] scaffold0045 (3 HSPs) |
 |  |  |
|
| [»] scaffold0457 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0045 (Bit Score: 158; Significance: 3e-84; HSPs: 3)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 178
Target Start/End: Complemental strand, 25193 - 25017
Alignment:
| Q |
1 |
acgggtgtccctgaaacaccagttaaagaaacaaaaaataatcattttcatagattcaaggagttaattgaagcaaaacttgttgaaaattaatgaaatg |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
25193 |
acgggtgcccctgaaacaccagttaaagaaacaaaaaataat-attttcatagattcaaggagttaattgaagcaaaacttgttgataattaatggaatg |
25095 |
T |
 |
| Q |
101 |
ggagtttaatcgaacctgaagagcatggtggtatgcaaaaccaggaatgttaattggataggctctcactcctagaag |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25094 |
ggagtttaatcgaacctgaagagcatggtggtatgcaaaaccaggaatgttaattggataggctctcactcctagaag |
25017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 32060 - 31995
Alignment:
| Q |
113 |
aacctgaagagcatggtggtatgcaaaaccaggaatgttaattggataggctctcactcctagaag |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||| |
|
|
| T |
32060 |
aacctgaagagcatggtggtatgcaaaaccaggaatgttaagtggataggctctcacacctggaag |
31995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 112 - 165
Target Start/End: Complemental strand, 39713 - 39660
Alignment:
| Q |
112 |
gaacctgaagagcatggtggtatgcaaaaccaggaatgttaattggataggctc |
165 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
39713 |
gaaccttaagagcatggtggtatgcaaaaccaggaatattaagtggataggctc |
39660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0457 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: scaffold0457
Description:
Target: scaffold0457; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 50 - 178
Target Start/End: Original strand, 5023 - 5151
Alignment:
| Q |
50 |
atagattcaaggagttaattgaagcaaaacttgttgaaaattaatgaaatgggagtttaatcgaacctgaagagcatggtggtatgcaaaaccaggaatg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5023 |
atagattcaaggagttaattgaagcaaaacttgttgatgattaattaaatgggagtttaatggaacctgaagagcatggtggtatgcaaaaccaggaatg |
5122 |
T |
 |
| Q |
150 |
ttaattggataggctctcactcctagaag |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5123 |
ttaattggataggctctcactcctagaag |
5151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University