View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351_low_28 (Length: 350)
Name: NF1351_low_28
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 8e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 42 - 224
Target Start/End: Original strand, 25101455 - 25101638
Alignment:
| Q |
42 |
cttttactactgcaatttacggccccccgtttgaacgtctacccaagaagtggtaatgacatgttgcatcaaattgacgtgcaacaagaaaagagtctta |
141 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25101455 |
cttttactactgcaatttacggcctcccgtttgaacgtctacacaagaagtggtaatgacatgttgcatcaaattgacgtgcaacaagaaaagagtctta |
25101554 |
T |
 |
| Q |
142 |
caagaaaaacaaacatatttttagaatgatggaattgcccatgtgatgaaaaatgagttaataacattggta-attgtaggagg |
224 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
25101555 |
caagaaaaacaaacatttttttagaatgatggaattgcccatgcgatgaaaaatgagttaatgacattggtatattgtaggagg |
25101638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 313 - 344
Target Start/End: Original strand, 12636936 - 12636967
Alignment:
| Q |
313 |
ggtttaagtttgtgcaaacaggttgatatttg |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12636936 |
ggtttaagtttgtgcaaacaggttgatatttg |
12636967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University