View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351_low_34 (Length: 311)
Name: NF1351_low_34
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 15 - 301
Target Start/End: Complemental strand, 47120353 - 47120067
Alignment:
| Q |
15 |
aaggtaagtagcccaagagtagctggatatgaaaatcataacaggacaatcagttgcttgtgtgcagacatagccacaatcagagagctttatacttttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47120353 |
aaggtaagtagcccaagagtagctggatatgaaaatcataacaggacaatcagttgcttgtgtgcagacatagccacaatcagagagctttatacttttg |
47120254 |
T |
 |
| Q |
115 |
caaagttaatcttatttcttttcttgttgaacaagctaatcaaagcataataaacgctaggtaagattagcacaaaatttatgacaacattgtccgtatc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47120253 |
caaagttaatcttatttcttttcttgttgaacaagctaatcaaagcataataaacgctaggtaagattagcacaaaatttatgacaacattgtccgtatc |
47120154 |
T |
 |
| Q |
215 |
aattggacaccaacaccatttgtgtacatcagaagcacaattttagttactttgtgtgctcctactgctaaagtacttatcaacatc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47120153 |
aattggacaccaacaccatttgtgtacatcagaagcacaattttagttactttgtgtgctcctactgctaaagtacttatcaacatc |
47120067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University