View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351_low_39 (Length: 282)
Name: NF1351_low_39
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 273
Target Start/End: Original strand, 32042176 - 32042427
Alignment:
| Q |
29 |
acgttgcccttcttgctgtgtgattggttatgaatgcaagcttcactttctttcctgccatggtggtattgagagnnnnnnnntagtaaattgggagagc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32042176 |
acgttgcccttcttgctgtgtgattggttatgaatgcaagcttcactttctttcctgccatggtggtattgagaaaaaaaatatagtaaattgggagagc |
32042275 |
T |
 |
| Q |
129 |
aagaaggaaattgtaggaaggtatttgttgtgatttaatttacttcttgagatatgttcttaatttataga-------ggatacataatttaatttttgt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
32042276 |
aagaaggaaattgtaggaaggtatttgttgtgatttaatttgcttcttgagatatgttcttaatttatagagccattgggagacataatttaatttttgt |
32042375 |
T |
 |
| Q |
222 |
taatattataattataccacctctggcaaacactcatgtattctagaattat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32042376 |
taatattataattataccacctctggcaaacactcatgtattctagaattat |
32042427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University