View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351_low_41 (Length: 276)
Name: NF1351_low_41
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 16 - 186
Target Start/End: Original strand, 25101744 - 25101914
Alignment:
| Q |
16 |
tctgggtcaaatttttcggtagcagtaacttttatattggatcagtctatataaaattttacttcgatttctattaagagtatgtttatttggacagtag |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25101744 |
tctgggtcaaatatttcggtagcagtaatttttatattggatcagtctatataaaattttacttcgatttctattaagagtatgtttatttggacagtag |
25101843 |
T |
|
| Q |
116 |
aattagtgtttgtttggtgcaatgttgcaaaacagagtttgacgaaaattacggtaaaaaattatattaac |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
25101844 |
aattagtgtttgtttggtgcaatgttgcaaaacaaagtttgacgaaaatcacggtaaaaaactatgttaac |
25101914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 193 - 247
Target Start/End: Original strand, 41386882 - 41386936
Alignment:
| Q |
193 |
ttattgttgttgatgtcggatcttgaagaggttaatgtgttttcagaaatggcag |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41386882 |
ttattgttgttgatgtcggatcttgaagaggttaatgtgttttcagaaatggcag |
41386936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 193 - 247
Target Start/End: Complemental strand, 37559664 - 37559610
Alignment:
| Q |
193 |
ttattgttgttgatgtcggatcttgaagaggttaatgtgttttcagaaatggcag |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37559664 |
ttattgttgttgatgtcggatcttgaagaggttaatgtgttttcagaaatggcag |
37559610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 196 - 247
Target Start/End: Original strand, 48287842 - 48287893
Alignment:
| Q |
196 |
ttgttgttgatgtcggatcttgaagaggttaatgtgttttcagaaatggcag |
247 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
48287842 |
ttgttgttgatgtcggaccttgaagaggttaatgggttttcagaaatggcag |
48287893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University