View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351_low_43 (Length: 273)
Name: NF1351_low_43
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 144 - 244
Target Start/End: Original strand, 15935454 - 15935554
Alignment:
| Q |
144 |
acattacatacctgcaagccaccataatatatgaatccaacggaaccagcgtaaaggatacctaaaacaattagaaagaaacaaataagggatgtgatga |
243 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15935454 |
acattacatacctggaagccaccataatatatgaatccaacggaaccagcgtaaaggatacctaaaacaattagaaagaaacaaataagggttgtgatga |
15935553 |
T |
 |
| Q |
244 |
g |
244 |
Q |
| |
|
| |
|
|
| T |
15935554 |
g |
15935554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 12 - 67
Target Start/End: Original strand, 15934389 - 15934444
Alignment:
| Q |
12 |
gaatatgtaatggtttgtgattttttgggagatgataatggaaccaatttagagaa |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15934389 |
gaatatgtaatggtttgtgattttttgggagatgataatggaaccaatttagagaa |
15934444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 69 - 114
Target Start/End: Original strand, 15935389 - 15935434
Alignment:
| Q |
69 |
aaaacaaggaagggtaataaactgttagggttgagtggaatttgaa |
114 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15935389 |
aaaacaaggaagggtaataaattgttagggttgagtggaatttgaa |
15935434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 17 - 70
Target Start/End: Complemental strand, 18421718 - 18421666
Alignment:
| Q |
17 |
tgtaatggtttgtgattttttgggagatgataatggaaccaatttagagaataa |
70 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||| ||||||||| ||||| |
|
|
| T |
18421718 |
tgtaagggtttgtgactttt-gggagatgataatggaatcaatttagaaaataa |
18421666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University