View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351_low_50 (Length: 252)
Name: NF1351_low_50
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351_low_50 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 45 - 252
Target Start/End: Complemental strand, 51941988 - 51941782
Alignment:
| Q |
45 |
cttcttctctttgactaaaacacaatgacctgttgtttatgcgactaaaaacacaaactattgtatgcaatgaaacagtgcaaccctcccgtgctttaaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51941988 |
cttcttctctttgactaaaacacaatgacctgttgtttatgcgactaaaa-cacagactattgtatgcaatgaaacagtgcaaccctcccgtgctttaaa |
51941890 |
T |
 |
| Q |
145 |
tagaggtcgcataaaaaccctaaataagagacgattcattcttcttctccaagaaatagaggagccttaggagttaagacttgattttataatattgtta |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51941889 |
tagaggtcgcataaaaaccctaaataagagaagattcattcttcttctccaagaaatagaggagccttaggagttaagacttgattttataatattgtta |
51941790 |
T |
 |
| Q |
245 |
caatcttt |
252 |
Q |
| |
|
|||||||| |
|
|
| T |
51941789 |
caatcttt |
51941782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University