View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351_low_57 (Length: 251)
Name: NF1351_low_57
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351_low_57 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 13 - 193
Target Start/End: Complemental strand, 41807022 - 41806842
Alignment:
| Q |
13 |
aatataattttactttacctcattctatgttttgtttttcctccgattttcgctttgagtgggacctctataatttaacaaaaacagtttgaactacaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41807022 |
aatataattttactttacctcattctatgttttgtttttcctccgattttcgctttgagtgggacctctataatttaacaaaaacagtttgaactacaaa |
41806923 |
T |
|
| Q |
113 |
caaccaatttgaatcccaactagaccatgtaattcaaccgaaaactcaaaaaaggagagatgtacggatattagtatctct |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41806922 |
caaccaatttgaatcccaactagaccatgtaattcaaccgaaaactcaaaaaaggaaagatgtacggatattagtatctct |
41806842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 38 - 110
Target Start/End: Original strand, 42032596 - 42032668
Alignment:
| Q |
38 |
tatgttttgtttttcctccgattttcgctttgagtgggacctctataatttaacaaaaacagtttgaactaca |
110 |
Q |
| |
|
||||||||||||||||| ||| ||||| |||||| |||| | |||||||||||||||||||||||||||||| |
|
|
| T |
42032596 |
tatgttttgtttttccttcgactttcgtgttgagttggacgtttataatttaacaaaaacagtttgaactaca |
42032668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University