View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1351_low_59 (Length: 251)
Name: NF1351_low_59
Description: NF1351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1351_low_59 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 37294315 - 37294094
Alignment:
| Q |
30 |
atacaacacaatctttttacttcaaaagttaaagtaaggaaattcaaaattcctcatttgcacgnnnnnnngggcttattgcatatgattttacgttgaa |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
37294315 |
atacagcacaatctttttacttcaaaagttaaagtaaggaaattcaaaattcctcatttgcacgtttttttgggtttattgcatatgattttacgttgaa |
37294216 |
T |
|
| Q |
130 |
taaccgaggaatgattctaatgtttgataatgaaggtttaacaaaaatggttataattgaatctcttgaaaatgatataaatgtgttgtttatctttgtg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37294215 |
gaaccgaggaatgattctaatgtttgataatgaagatttaacaaaaatggttatgattgaatctcttgaaaataatataaatgtgttgtttatctttgtg |
37294116 |
T |
|
| Q |
230 |
aaaaacaatctaaaccattaaa |
251 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37294115 |
aaaaacaatctaaaccattaaa |
37294094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University