View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13520_high_4 (Length: 448)
Name: NF13520_high_4
Description: NF13520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13520_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 390; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 390; E-Value: 0
Query Start/End: Original strand, 19 - 436
Target Start/End: Complemental strand, 48398421 - 48398004
Alignment:
| Q |
19 |
taagaagcattagcaactttatcatttggacttctaacaacccataaaaaccgttgctcactcatttccaagccaagtgccaattcaactatctgtttac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48398421 |
taagaagcattagcaactttatcatttggacttctaacaacccataaaaaccgttgctcactcatttccaagccaagtgccaattcaactatctgtttac |
48398322 |
T |
|
| Q |
119 |
tagagagggtcccaccacttccaaaagaaacaaacagaacactcccgtgtgcttgattatctaaccatttcaaactctctgagttcggtccaatttgacc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48398321 |
tagagagggtcccaccacttccaaaagaaacaaacagaacactcccatgtggttgattatctaaccatttcaaactctctgagttcggtccaatttgacc |
48398222 |
T |
|
| Q |
219 |
tacttctacttctctctgtactaatggtccaaccgggtaaaacttaggttttccaggttcttcctttagtaactccttgattggacccggttcaagttca |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48398221 |
tacttctacttctctctttactaatggtccaaccgggtaaaacttaggttttcctggttcttcctttagtaactccttgattggacccggttcaagttca |
48398122 |
T |
|
| Q |
319 |
agaaaactgttctctataagtccatctgcttctctgtatctcttcgcgttgcgaaagacactttggtaagcatcgttcttcctgtcttgaagcgggtcta |
418 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48398121 |
agaaaactattctctataagtccatctgcttctctgtatctcttcgcgttgcgaaagacactttggtaagcatcgttcttcctgtcttgaagagggtcta |
48398022 |
T |
|
| Q |
419 |
gtaaatatttacagtgaa |
436 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
48398021 |
gtaaatatttaccgtgaa |
48398004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University