View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13520_high_7 (Length: 327)
Name: NF13520_high_7
Description: NF13520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13520_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 10 - 309
Target Start/End: Original strand, 29663057 - 29663356
Alignment:
| Q |
10 |
gcagagagggagtttcatggcttggaaggggattatctgggaccaatttcatcccctgatatgtagctactactatttcttcttaggttaggtttcattg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29663057 |
gcagagagggagtttcatggcttggaaggggattatctgggatcaatttcatcccctgatatgtagctactactatttcttcttaggttaggtttcattg |
29663156 |
T |
|
| Q |
110 |
tgaaatcaaaaccacattttggtgtaggatttcactgttttgctttcttagtccaaatcatggaaaccattaatcaaattaatgcatggggtttagtctg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29663157 |
tgaaatcaaaaccacattttggtgtaggatttcactgttttgctttcttagtccaaatcatggaaaccattaatcaaattaatgcatggggtttagtctg |
29663256 |
T |
|
| Q |
210 |
taaataatctatgttctatatgcctactactgtcctgatattttatgtgttattctatacactgttaacttaatattcttgctttcttctataatgaacg |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29663257 |
taaataatctatgttctatatgcctactactgtcctgatattttatgtgttattctatacactattaacttaatattcttgctttcttctataatgaacg |
29663356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 27 - 77
Target Start/End: Complemental strand, 33201374 - 33201324
Alignment:
| Q |
27 |
tggcttggaaggggattatctgggaccaatttcatcccctgatatgtagct |
77 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33201374 |
tggcttggaaggggattatctaggaccaatttcatcccctgatatgtagct |
33201324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University