View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13520_low_3 (Length: 466)
Name: NF13520_low_3
Description: NF13520
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13520_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 2e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 12 - 85
Target Start/End: Original strand, 49496123 - 49496196
Alignment:
| Q |
12 |
atgaacaaattaaactgagacaaatctctattaatatgataattctactagaaccgttcattctaagaattaaa |
85 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49496123 |
atgaacaaattaaactgagacaaatctatattaatatgataattctactagaaccgttcattctaagaattaaa |
49496196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 353 - 448
Target Start/End: Original strand, 49484093 - 49484188
Alignment:
| Q |
353 |
ttgatgttcaggtagtttgcagataaaacgagatcaaacaaatttatacggtcaacattgatgaattcaacatcctaatccttgagatcaacatct |
448 |
Q |
| |
|
|||||||||| |||||||| ||||||||| || ||||||||| || || || |||||||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
49484093 |
ttgatgttcatgtagtttgaagataaaacaaggtcaaacaaagttgtatagtgaacattgacgaattcaacatcccaatccatgagatcaacatct |
49484188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University