View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13521_low_2 (Length: 439)
Name: NF13521_low_2
Description: NF13521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13521_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 20 - 351
Target Start/End: Complemental strand, 21144927 - 21144596
Alignment:
| Q |
20 |
cctttaaccccttttagtttctcttttaacacaaatcccatccatcacgttaaatgttgtgaattccacacctcctcaaccacctctttgatttgcctat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144927 |
cctttaaccccttttagtttctcttttaacagaaatcccatccatcacgttaaatgttgtgaattccacacctcctcaaccacctctttgatttgcctat |
21144828 |
T |
 |
| Q |
120 |
tatccaaccaatagtgtagattttgattctagccacatccaatatcctccttaaaattgtatcctcatcaaaatccaagaactcaccaaattggtctcca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21144827 |
tatccaaccaatagtgtagattttgattctagccacatccaatatcctccttaaaattgtatcctcatcaaaatccaagaactcaccaaattggtctcca |
21144728 |
T |
 |
| Q |
220 |
atctgcttgaaagcctcttcatcccagacatgaactggtaaacttaggattttaatccaaacagttattttgctggccactaagcttggattccattcct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21144727 |
atctgcttgaaagcctcttcatcccagacatgaactggtaaacttaggattttaatccaaacagttcttttgctggccactaagcttggattccattcct |
21144628 |
T |
 |
| Q |
320 |
tcatctccctaaaatgagaatcccaccaaaat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21144627 |
tcatctccctaaaatgagaatcccaccaaaat |
21144596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University