View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13521_low_6 (Length: 222)
Name: NF13521_low_6
Description: NF13521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13521_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 7e-42; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 77 - 204
Target Start/End: Complemental strand, 26415477 - 26415351
Alignment:
| Q |
77 |
gaaatcaggaggggtataatcgaaattgatgaaagaattggcgagagcgaaatcatcgtcgttgtccatggnnnnnnnnaggcacaaccgtagaggaatt |
176 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26415477 |
gaaaacaggaggggtataatcgaaattgatgaaagaattggcgagagcgaaatcatcgtcgttgtccatgg-tttttttaggcacaaccgtagaggaatt |
26415379 |
T |
|
| Q |
177 |
agggttacaaagataaacacatagattt |
204 |
Q |
| |
|
||||||| ||||||||||||| |||||| |
|
|
| T |
26415378 |
agggttagaaagataaacacaaagattt |
26415351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 85 - 146
Target Start/End: Original strand, 26416715 - 26416776
Alignment:
| Q |
85 |
gaggggtataatcgaaattgatgaaagaattggcgagagcgaaatcatcgtcgttgtccatg |
146 |
Q |
| |
|
|||||||||| | | |||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
26416715 |
gaggggtatatttgtaattgatgaaagaattggtaagagcaaaatcatcgtcgttgtccatg |
26416776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 36 - 76
Target Start/End: Complemental strand, 26415544 - 26415504
Alignment:
| Q |
36 |
aacttgtaaatctttcttcaacaccgaaacacacgacgaga |
76 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26415544 |
aacttttaaatctttcttcaacaccgaaacacacgacgaga |
26415504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University