View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13523_high_12 (Length: 309)
Name: NF13523_high_12
Description: NF13523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13523_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 2 - 157
Target Start/End: Original strand, 43903110 - 43903265
Alignment:
| Q |
2 |
atatatactagtgagcgatattttcggctaaaaggatacaaaactaggaacaagtcatccatcatgttacaaattgacatgcccccactcactctaacca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43903110 |
atatatactagtgagcgatattttcggctaaaaggatacaaaactaggaacaagtcatccatcatgttacaaattgacgtgcccccactcactctaacca |
43903209 |
T |
|
| Q |
102 |
aacattagaatgatgataacctgaaatcaagcatgaacgaactcgtgctttttagt |
157 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43903210 |
aacattataatgatgataacctgaaatcaagcatgaacgaactcgtgctttttagt |
43903265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 162 - 234
Target Start/End: Original strand, 43903311 - 43903383
Alignment:
| Q |
162 |
tttgcaaaataaaaaagcataagaaaattctcctcaaatgataatcattacattgatcaccacaaagttatgg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||||| |
|
|
| T |
43903311 |
tttgcaaaataaaaaagcataagaaaattctcctcaaatgataatcattacattgatgatcataaagttatgg |
43903383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University