View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13524_high_2 (Length: 237)
Name: NF13524_high_2
Description: NF13524
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13524_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 42879090 - 42879300
Alignment:
| Q |
13 |
aacaatatgtacatagtccatagaggtttgaaattgaatgataatactattactacatagcagatgcatttgatattgatgatcgtatctggtgagtttg |
112 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42879090 |
aacaaaatgtacatagtccatagaggtttgaaattgaatgataatactattactacatagcagatgcatttgatattgatgatcgtatctggtgagtttg |
42879189 |
T |
 |
| Q |
113 |
gttggcaacttggcacatgaaattgatccgttaatggcgtttgaatgctgcactctgatccgtaagagtaatcaaggctaaagtaacagaggcccctgtc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42879190 |
gttggcaacttggcacatgaaattgatccgttaatggcgtttgaatgctgcactctgatccgtaagagtaatcaaagctaaagtaacagaggcccctgtc |
42879289 |
T |
 |
| Q |
213 |
gagttcttaat |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
42879290 |
gagttcttaat |
42879300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University