View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13526_high_2 (Length: 253)
Name: NF13526_high_2
Description: NF13526
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13526_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 56 - 238
Target Start/End: Complemental strand, 4579079 - 4578897
Alignment:
| Q |
56 |
tatcaagcatacataagatcagctactttatagaacaggttttaacataggaccatgaatgaaactaatatgagattttggttgtctttcatatccagga |
155 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4579079 |
tatcaggcgtacataagatcagctactttatagaacaggttttaacataggaccatgaataaaactaatatgagattttggttgtctttcatatccagga |
4578980 |
T |
 |
| Q |
156 |
attaaagaatatttcccgaaatatgtatgaacattctaaaaaacaatgattcggttgaacaaaccatggttgaatgaggttct |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4578979 |
attaaagaatatttcccgaaatatgtatgaacattcgaaaaaacaatgattcggttgaataaaccatggttgaatgaggttct |
4578897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 4579164 - 4579107
Alignment:
| Q |
1 |
ttgagtactactatgcaattatacttgtgattttcaatatcatcaaagaacagcctat |
58 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
4579164 |
ttgagtactactatgcaattatactattcattttcaatatcatcaaagaacagcctat |
4579107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University