View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13528_low_4 (Length: 233)
Name: NF13528_low_4
Description: NF13528
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13528_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 216
Target Start/End: Original strand, 27177876 - 27178075
Alignment:
| Q |
17 |
agtatactgttttcttttactatctgtgaccctacacgccactcttgtttcatatttatgtataatacttgcaggacaaacttacaccagcttgcatatg |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27177876 |
agtatactgttttcttttactatctatgaccctacacgccactcttgtttcatatttatgtataatacttgcaggacaaacttacaccagcttgcatatg |
27177975 |
T |
 |
| Q |
117 |
ttgtctttttctctgttatccacttcgaatgtggcaaatcaaacttcatttctcgtgaatgaatcaatttactgttttcattcttctagttcgtttccct |
216 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
27177976 |
ttgtctttttctctgatatccacttcgaatgtggcaaatcaaacttcatttctcgtgaatgaattaacttactgttttcattcttctagttcgtttccct |
27178075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University