View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13529_high_11 (Length: 354)
Name: NF13529_high_11
Description: NF13529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13529_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 30 - 214
Target Start/End: Original strand, 44285707 - 44285890
Alignment:
| Q |
30 |
cttctcccagtctcggactcagccttttagccgattcgcacctttactctctgtctcaatcgagccggtcagatcaatagagaagtcaggcactcgatag |
129 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| | |
|
|
| T |
44285707 |
cttctcccaatctcggactcgaccttttagccgattcgcacctttactctctgtctcaatcaattcggtcagatcaatagagaagtcaggcactcgattg |
44285806 |
T |
|
| Q |
130 |
acttaaaggaaggttccgcccgtaaatttcttgatcaatgttaccgggaagcagcaacagagacagattgagtgctaaagcttct |
214 |
Q |
| |
|
|||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
44285807 |
acttaaaggaagattccg-ccgtaaattgattgatcaatgttaccgggaagcagcaacagagatggattgagtactaaagcttct |
44285890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 30 - 211
Target Start/End: Complemental strand, 44070306 - 44070126
Alignment:
| Q |
30 |
cttctcccagtctcggactcagccttttagccgattcgcacctttactctctgtctcaatcgagccggtcagatcaatagagaagtcaggcactcgatag |
129 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
44070306 |
cttctcccaatctcggactcagccgtttagccggtttgcacctttactctctgtctcaatctagccggtcagatcaatagagaagtcaggcacttgattg |
44070207 |
T |
|
| Q |
130 |
acttaaaggaaggttccgcccgtaaatttcttgatcaatgttaccgggaagcagcaacagagacagattgagtgctaaagct |
211 |
Q |
| |
|
|||||||||||||||||| |||| |||| ||||| ||||| || ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44070206 |
acttaaaggaaggttccg-ccgttaattgattgattgatgttgccaggaagcagcaacagagacagattgagtactaaagct |
44070126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 116 - 211
Target Start/End: Complemental strand, 16443843 - 16443749
Alignment:
| Q |
116 |
caggcactcgatagacttaaaggaaggttccgcccgtaaatttcttgatcaatgttaccgggaagcagcaacagagacagattgagtgctaaagct |
211 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| || |||| ||||| ||||| || ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16443843 |
caggcacttgattgacttaaaggaaggttccgcc-gttaattgattgattgatgttgccaggaagcagcaacagagacagattgagtactaaagct |
16443749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University