View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13529_high_23 (Length: 307)
Name: NF13529_high_23
Description: NF13529
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13529_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 22155305 - 22155004
Alignment:
| Q |
1 |
tctctccttgcccaatccatgtcagaactgtccctatctttttgcctatcaaatccgtcagtatttgtatgcaattgatgggccaagctacgatgccggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155305 |
tctctccttgcccaatccatgtcagaactgtccctatctttttgcctatcaaatccgtcagtatttgtatgcaattgatgggccaagctacgatgccggt |
22155206 |
T |
|
| Q |
101 |
ccttgtaagggtatgatccatctctacctctaagtaccatgtgatttctttcgggatcttgctttccatcatgctcttttctatagaatccctgctcatt |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155205 |
ccttgtaagggtatgatccctctctacctctaagtaccatgtgatttctttcgggatcttgctttccatcatgctcttttctatagaatccctgctcatt |
22155106 |
T |
|
| Q |
201 |
ttcatcagggtgttgtctgatgctagccagacgtgttgatcgtggatcctggactacttcttcatcaagaccctctcgtcgcttctgattatctctgctg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155105 |
ttcatcagggtgttgtctgatgctagccagacgtgttgatcgtggatcctggactacttcttcatcaagaccctctcgtcgcttctgattatctctgctg |
22155006 |
T |
|
| Q |
301 |
ct |
302 |
Q |
| |
|
|| |
|
|
| T |
22155005 |
ct |
22155004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University