View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1352_high_6 (Length: 344)
Name: NF1352_high_6
Description: NF1352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1352_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 90 - 248
Target Start/End: Original strand, 44000761 - 44000919
Alignment:
| Q |
90 |
agtgtgcgagctgccatgatgagagcacgtgaatgtgattgcctctcggtgtttcttgttcttgtaatgatttagtgataaaaaagaaacaaaacttatc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44000761 |
agtgtgcgagctgccatgatgagagcacgtgaatgtgattgcctgtcggtgtttcttgttcttgtaatgatttagtgataaaaaagaaacaaaacttatc |
44000860 |
T |
|
| Q |
190 |
aatgtgaaaaatgacttttcatatgcaccatttgtttggtaaccgttgttgttgatgat |
248 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44000861 |
aatgtgaaaaatgatttttcatatgcaccatttgtttggtaaccgttgttgttgttgat |
44000919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University