View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1352_high_9 (Length: 251)

Name: NF1352_high_9
Description: NF1352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1352_high_9
NF1352_high_9
[»] chr6 (1 HSPs)
chr6 (134-251)||(31410237-31410354)


Alignment Details
Target: chr6 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 134 - 251
Target Start/End: Complemental strand, 31410354 - 31410237
Alignment:
134 ccatgagtatgtttgcgtaacaaaataattaaattaatagatataatggtgaaaatgcctaactgatattccataaattgcttcttcatttatgaaattt 233  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31410354 ccatgagtatgtttgcgtaaaaaaataattaaattaatagatataatggtgaaaatgcctaactgatattccataaattgcttcttcatttatgaaattt 31410255  T
234 cattgttaatatttatta 251  Q
    ||||||||||||||||||    
31410254 cattgttaatatttatta 31410237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University