View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1352_low_11 (Length: 251)
Name: NF1352_low_11
Description: NF1352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1352_low_11 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 134 - 251
Target Start/End: Complemental strand, 31410354 - 31410237
Alignment:
| Q |
134 |
ccatgagtatgtttgcgtaacaaaataattaaattaatagatataatggtgaaaatgcctaactgatattccataaattgcttcttcatttatgaaattt |
233 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31410354 |
ccatgagtatgtttgcgtaaaaaaataattaaattaatagatataatggtgaaaatgcctaactgatattccataaattgcttcttcatttatgaaattt |
31410255 |
T |
 |
| Q |
234 |
cattgttaatatttatta |
251 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31410254 |
cattgttaatatttatta |
31410237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University