View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1353-INSERTION-2 (Length: 184)
Name: NF1353-INSERTION-2
Description: NF1353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1353-INSERTION-2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 8 - 157
Target Start/End: Complemental strand, 3168175 - 3168026
Alignment:
| Q |
8 |
atgtccagattatagccagcctaagcataannnnnnngtcaaagacaactcagaaatataaaatcttggccaaacaacttttacactttcttatatgatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3168175 |
atgtccagattatagccagcctaagcataaattttttgtcaaagacaactcagaaatataaaatcttggccaaacaacttttacactttcttatatgatt |
3168076 |
T |
|
| Q |
108 |
tagtttgtgtggggttgatgacgagtttaataaaatcagggtagcactgt |
157 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3168075 |
tagtttgtgtggggctgacgacgagtttaataaaatcagggtagcactgt |
3168026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University