View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13530_low_5 (Length: 318)
Name: NF13530_low_5
Description: NF13530
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13530_low_5 |
 |  |
|
| [»] scaffold0141 (1 HSPs) |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0141 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: scaffold0141
Description:
Target: scaffold0141; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 188 - 318
Target Start/End: Complemental strand, 6329 - 6199
Alignment:
| Q |
188 |
agattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgccttgcaagattgagatatca |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6329 |
agattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgccttgcaagattgagatatca |
6230 |
T |
 |
| Q |
288 |
aggctggtaccaaagcaaagagaagaataag |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6229 |
aggctggtaccaaagcaaagagaagaataag |
6199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 131; Significance: 6e-68; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 168 - 318
Target Start/End: Original strand, 49237921 - 49238071
Alignment:
| Q |
168 |
cagactgcctctttctagatagattctatggatgctgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccgatgcctgtcgtgc |
267 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| | |
|
|
| T |
49237921 |
cagactgcctatttctagatagattctatggatgatgatctgtctctttattggaccaaagagtggctctccgcggagttcgttccaatgcatgtcgtac |
49238020 |
T |
 |
| Q |
268 |
cttgcaagattgagatatcaaggctggtaccaaagcaaagagaagaataag |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49238021 |
cttgcaagattgagatatcaaggctggtaccaaagcaaagagaagaataag |
49238071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 13 - 122
Target Start/End: Complemental strand, 44285712 - 44285603
Alignment:
| Q |
13 |
gagatgaactagcaagaaatgcagacttcgctccgcacctttaggtaaagatccccattgtccaatcttcctttaatggatatattcttaaatgtaactt |
112 |
Q |
| |
|
|||| ||||||||||||||||| || || |||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44285712 |
gagaagaactagcaagaaatgccgaatttgctccgcatcgttaggtaaagatccccattggccaatcttcctttaatggatatattcttcaatgtaactt |
44285613 |
T |
 |
| Q |
113 |
ccggtaagaa |
122 |
Q |
| |
|
|||||||||| |
|
|
| T |
44285612 |
ccggtaagaa |
44285603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 13 - 122
Target Start/End: Original strand, 44070301 - 44070410
Alignment:
| Q |
13 |
gagatgaactagcaagaaatgcagacttcgctccgcacctttaggtaaagatccccattgtccaatcttcctttaatggatatattcttaaatgtaactt |
112 |
Q |
| |
|
|||| ||||||||||||||||| || ||||||||||| | ||||||||||| ||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
44070301 |
gagaagaactagcaagaaatgccgaattcgctccgcattgtaaggtaaagatctccattgtccaatcttgctttaatggatatattcttcaatgtaactt |
44070400 |
T |
 |
| Q |
113 |
ccggtaagaa |
122 |
Q |
| |
|
| |||||||| |
|
|
| T |
44070401 |
ctggtaagaa |
44070410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University