View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13531_high_4 (Length: 343)
Name: NF13531_high_4
Description: NF13531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13531_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 35373532 - 35373218
Alignment:
| Q |
1 |
acaacaaattgacactacaaaatttcaaagagactagaaatgaaagaatataaaatttcaaagagacta---aaattgaacacaaactaaaattgctagt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || | | | ||||||||||||||||||||||||| |
|
|
| T |
35373532 |
acaacaaattgacactacaaaatttcaaagagactaaaaatgaaagaatataaaatttcagggacattttttattttgaacacaaactaaaattgctagt |
35373433 |
T |
 |
| Q |
98 |
tattgccttatatagaaatgtcgaaaagttattgacaaaaattaatcgctcaagtaatatcgataaattgagatataaaatgaaagtaaccattcacttt |
197 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35373432 |
t---gccttatatagaaatgtcgaaaagttattgacaaaaattaatcgatcaagtaatatcgataaatcgagatataaaatgaaagtaaccattcacttt |
35373336 |
T |
 |
| Q |
198 |
tagtagtaatttcaaaacatcttaaatttaaatagcataaatggannnnnnnnnnnnnnnnnagaacatacatggaaatcttagagttcaaaaactccgg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35373335 |
tagtagtaatttcaaaacatcttaaatttaaatagcatacatgg------------ttttttagaacatacatggaaatcttagagttcaaaaactccgg |
35373248 |
T |
 |
| Q |
298 |
tcaaccttcatgttttgataatgaaaaaca |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35373247 |
tcaaccttcatgttttgataatgaaaaaca |
35373218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University