View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13531_low_5 (Length: 329)
Name: NF13531_low_5
Description: NF13531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13531_low_5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 191 - 329
Target Start/End: Original strand, 10470124 - 10470262
Alignment:
| Q |
191 |
gctatgcgttctttattctgctgcgtattacggaccacgttacctattgagcaaggagcagcatttcaactctcgagtacttgagagatcatgatgtttc |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470124 |
gctatgcgttctttattctgctgcgtattacggaccacgttacctattgagcaaggagcagcatttcaactctcgagtacttgagagatcatgatgtttc |
10470223 |
T |
 |
| Q |
291 |
ttttctggaactttatgttctttcactattggattggtc |
329 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
10470224 |
ttttcaggaactttatgttctttcactgttggattggtc |
10470262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University