View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13531_low_9 (Length: 253)
Name: NF13531_low_9
Description: NF13531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13531_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 20 - 211
Target Start/End: Original strand, 47116941 - 47117128
Alignment:
| Q |
20 |
aaatattcataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgtatcaatgactcgatcgatcaccttttaacgattatttttaattt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47116941 |
aaatattcataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgtatcaatgactcga----tcaccttttaacgattatttttaattt |
47117036 |
T |
 |
| Q |
120 |
cttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccatcttcgccggtgatgatgtc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
47117037 |
cttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaacgccaacatcaccgtcttcaccggtgatgatgtc |
47117128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University