View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13532_low_4 (Length: 210)
Name: NF13532_low_4
Description: NF13532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13532_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 41 - 194
Target Start/End: Complemental strand, 36836828 - 36836673
Alignment:
| Q |
41 |
agaaagcgggaacaggaagaatctttgtggtgtgtgagtgacgagggagtgcgttgtattttattttattaata--aattgttatttttgttgtctgttc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36836828 |
agaaagcgggaacaggaagaatctttgtggtgtgtgagtgacgagggagtgcgttgtattttattttattaatattaattgttatttttgttgtctgttc |
36836729 |
T |
 |
| Q |
139 |
ttgcttgttccttcgctcttgatacttctgagagcgggtacagtgcaggttgtcaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36836728 |
ttgcttgttccttcgctcttgatacttctgagagcgggtacagtgcaggttgtcaa |
36836673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University