View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13533_low_8 (Length: 289)
Name: NF13533_low_8
Description: NF13533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13533_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 43349656 - 43349933
Alignment:
| Q |
1 |
ctttgtctctacagtataatatactctggtttgtggctctggtttctccttcattgtccattgccgaagccgcactcacaagaaaccctctctcttgcag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43349656 |
ctttgtctctacagtataatatactctggtttgtggctctggtttctccttcattgtccattgccgaaggcgcactcacaagaaaccctctctcttgcag |
43349755 |
T |
|
| Q |
101 |
tatattctggaaccttcttctaaacatggagcgcatcgttggcggcagctacaagctcggccgcaagatcggaagtggatccttcggtgaaatttacctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43349756 |
tatattctggaaccttcttctaaacatggagcgcatcgttggcggcagctacaagctcggccgcaagatcggaagtggatccttcggtgaaatttacctc |
43349855 |
T |
|
| Q |
201 |
ggtgactatcctctctattccgttcttcttttcattcacaacgattctttcttcttatcactcctttaacgttttcat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43349856 |
ggtgactatcctctctattccgttcttcttttcattcacaacgattctttcttcttatcactcctttaacgttttcat |
43349933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 162 - 203
Target Start/End: Original strand, 33473049 - 33473090
Alignment:
| Q |
162 |
cgcaagatcggaagtggatccttcggtgaaatttacctcggt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
33473049 |
cgcaagatcggaagtggatccttcggtgaaatctatctcggt |
33473090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University