View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13535_low_7 (Length: 281)
Name: NF13535_low_7
Description: NF13535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13535_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 49 - 273
Target Start/End: Original strand, 6329671 - 6329895
Alignment:
| Q |
49 |
accctaacatcctctttctaaattaatttgaattgtgagattttaatttatttctacaatctatttactttgttggaaaaatatctccgtaacaccctat |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6329671 |
accctaacatcctctttctaaattaatttgaattgtgagattttaatttatttctacaatctatttactttgttggaaaaatatctccataacaccctat |
6329770 |
T |
 |
| Q |
149 |
tttatttagtaaaatctttgtccatctatccacttgatacgagacaactccaaaatggtagaaatacatgtgagtattatcaaaaaattcaaccatgttt |
248 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6329771 |
tttatttagtaaaatttatgtccatctatccacttgatacgagacaactccaaaatggtagaaatacatgtgagtattatcaaaaaattcaaccatgttt |
6329870 |
T |
 |
| Q |
249 |
aatgttcgtttttatttggcacagg |
273 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
6329871 |
aatgttcgtttttatttggcacagg |
6329895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University