View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13537_low_2 (Length: 326)
Name: NF13537_low_2
Description: NF13537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13537_low_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 17 - 324
Target Start/End: Original strand, 43466082 - 43466382
Alignment:
| Q |
17 |
cactactaacgtggataggagaactactgaggaggctagtattcttttcatgatgttgaattattgtcaccttttaaggttggtaattctgcataaccta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43466082 |
cactactaacgtggataggagaactactggggaggctagtgttcttttcatgatgttgaattattgtcaccttttaaggttggtaattctgcataaccta |
43466181 |
T |
|
| Q |
117 |
cttaagcgtaaagtgattactgatcctagtggcacctcttgtgcattttgtggtgcttccatgtagtcgttttaggtggttatgttggagtttgtctcca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43466182 |
cttaagcgtaaagtgattactgatcctagtggcacctcttgtgcaatttgtggtgcttccatgtagtcgttttaggtggttatgttggagtttgtctcca |
43466281 |
T |
|
| Q |
217 |
cgggatgtggtggctatctttgtcttttttccaaggtccagaagttggttgtagagattggtttggactttggtatctattttgttttgcatgtttttct |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||||| | |
|
|
| T |
43466282 |
cgggatgtggtggctatctttgtcttttttccaaggtccagaagttggttgtagagattgg-------tttcgtatgtattttgttttgcatgtttttgt |
43466374 |
T |
|
| Q |
317 |
gtgctcct |
324 |
Q |
| |
|
||| |||| |
|
|
| T |
43466375 |
gtggtcct |
43466382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University