View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13538_low_11 (Length: 248)
Name: NF13538_low_11
Description: NF13538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13538_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 8372266 - 8372036
Alignment:
| Q |
1 |
cattcataagttggagaaaataattaatttaatgtttttagcttttcaattggagttcatgaaaggtggtgatgatacttttgtttagtttaatgtacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8372266 |
cattcataagttggagaaaataattaatttaatgtttttagcttttcaattggagttcatgaaaggtggtgatgatacttttgtttagtttaatgtacat |
8372167 |
T |
 |
| Q |
101 |
aagaaaacaccttgtatgttcatacattgaaccttgcatgttcttccacagaattctttgtctcatgtaaagcgaccaaatcactttcttttttatgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8372166 |
aagaaaacaccttgtatgttcatacattgaaccttgcatgttcttccacagaattctttgtctcatgtaaagcgaccaaatcactttcttttttatgaag |
8372067 |
T |
 |
| Q |
201 |
ataccaaaaggttagttaattaagagatatg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8372066 |
ataccaaaaggttagttaattaagagatatg |
8372036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University