View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13538_low_7 (Length: 354)
Name: NF13538_low_7
Description: NF13538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13538_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 6e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 40 - 160
Target Start/End: Original strand, 4774750 - 4774870
Alignment:
| Q |
40 |
tactggagaaacatttcgcaggagataatctcttccccttacttaaatgcatcaatgtctttcttttaagaatcgatatcaatttttgtttacggaacaa |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774750 |
tactggagaaacatttcgcaggagataatctcttccccttacttaaatgcatcaatgtctttcttttaagaatcgatatcaatttttgtttacggaacaa |
4774849 |
T |
|
| Q |
140 |
taaaataaaccgtttccttca |
160 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4774850 |
taaaataaaccgtttccttca |
4774870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 232 - 354
Target Start/End: Original strand, 4774941 - 4775063
Alignment:
| Q |
232 |
tttggggttaataccttaaataaacactaatttagcaatgactgattttcttaaaaggctnnnnnnntgatatattaacaaatcaggatcaactgtctca |
331 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||| |
|
|
| T |
4774941 |
tttggggttaatatcttaaataaacactaatttagcaatgactgattttcttaaaaggctaaaaaaatggtatattaacaaatcaggatcaactgtttca |
4775040 |
T |
|
| Q |
332 |
gcataggtgtacgaaaccaaccc |
354 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4775041 |
gcataggtgtacgaaaccaaccc |
4775063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University