View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13539_low_1 (Length: 296)
Name: NF13539_low_1
Description: NF13539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13539_low_1 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 217 - 266
Target Start/End: Original strand, 595534 - 595583
Alignment:
| Q |
217 |
ggatccacagtgaaacatggtgtggcagttgccacaccagattattccct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
595534 |
ggatccacagtgaaacatggtgtggcagttgccacaccagattattccct |
595583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 213 - 262
Target Start/End: Original strand, 841946 - 841995
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattatt |
262 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
841946 |
gggcggatccaccgtgaaacatggtgtggcagttgcaacaccagattatt |
841995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 210 - 259
Target Start/End: Complemental strand, 5014218 - 5014169
Alignment:
| Q |
210 |
caagggcggatccacagtgaaacatggtgtggcagttgccacaccagatt |
259 |
Q |
| |
|
||||||||||| | |||||||||||||||||||| |||||||||||||| |
|
|
| T |
5014218 |
caagggcggatgtagagtgaaacatggtgtggcagctgccacaccagatt |
5014169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 256
Target Start/End: Original strand, 13850509 - 13850538
Alignment:
| Q |
227 |
tgaaacatggtgtggcagttgccacaccag |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13850509 |
tgaaacatggtgtggcagttgccacaccag |
13850538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 12)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 266
Target Start/End: Complemental strand, 498081 - 498028
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccct |
266 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
498081 |
gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccct |
498028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 266
Target Start/End: Original strand, 50385860 - 50385913
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccct |
266 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50385860 |
gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccct |
50385913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 215 - 262
Target Start/End: Complemental strand, 43055652 - 43055605
Alignment:
| Q |
215 |
gcggatccacagtgaaacatggtgtggcagttgccacaccagattatt |
262 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43055652 |
gcggacccactgtgaaacatggtgtggcagttgccacaccagattatt |
43055605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 258
Target Start/End: Original strand, 22418556 - 22418601
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagat |
258 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
22418556 |
gggcggatctactgtgaaacatggtgtggcagttgccacaccagat |
22418601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 213 - 265
Target Start/End: Complemental strand, 53446074 - 53446022
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53446074 |
gggcggattcaccttgaaacatggtgtggcacttgccacaccagattattccc |
53446022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 213 - 256
Target Start/End: Complemental strand, 49430676 - 49430633
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccag |
256 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49430676 |
gggcggatccactttgaaacatggtgtggcagttgccacaccag |
49430633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 265
Target Start/End: Complemental strand, 24758640 - 24758602
Alignment:
| Q |
227 |
tgaaacatggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24758640 |
tgaaacatggtgtggcacttgccacaccagattattccc |
24758602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 265
Target Start/End: Complemental strand, 24767637 - 24767599
Alignment:
| Q |
227 |
tgaaacatggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24767637 |
tgaaacatggtgtggcacttgccacaccagattattccc |
24767599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Original strand, 2125280 - 2125313
Alignment:
| Q |
226 |
gtgaaacatggtgtggcagttgccacaccagatt |
259 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
2125280 |
gtgaaacatggtgtggcagctgccacaccagatt |
2125313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Original strand, 26555492 - 26555525
Alignment:
| Q |
226 |
gtgaaacatggtgtggcagttgccacaccagatt |
259 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
26555492 |
gtgaaacatggtgtggcagctgccacaccagatt |
26555525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Complemental strand, 28211775 - 28211742
Alignment:
| Q |
226 |
gtgaaacatggtgtggcagttgccacaccagatt |
259 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
28211775 |
gtgaaacatggtgtggcagctgccacaccagatt |
28211742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 217 - 265
Target Start/End: Complemental strand, 29694358 - 29694310
Alignment:
| Q |
217 |
ggatccacagtgaaacatggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
||||||||| |||| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
29694358 |
ggatccacattgaagcatggtgtggcaagtgccacaccaaattattccc |
29694310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 5e-19; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 213 - 265
Target Start/End: Complemental strand, 29247223 - 29247171
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29247223 |
gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
29247171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 33619691 - 33619647
Alignment:
| Q |
214 |
ggcggatccacagtgaaacatggtgtggcagttgccacaccagat |
258 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||| ||||| |
|
|
| T |
33619691 |
ggcggatctactgtgaaacatggtgtggcagttgccacatcagat |
33619647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Original strand, 28535209 - 28535242
Alignment:
| Q |
226 |
gtgaaacatggtgtggcagttgccacaccagatt |
259 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
28535209 |
gtgaaacatggtgtggcagctgccacaccagatt |
28535242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 5e-19; HSPs: 10)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 213 - 265
Target Start/End: Complemental strand, 46913510 - 46913458
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46913510 |
gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
46913458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 208 - 258
Target Start/End: Original strand, 28998018 - 28998068
Alignment:
| Q |
208 |
gtcaagggcggatccacagtgaaacatggtgtggcagttgccacaccagat |
258 |
Q |
| |
|
|||| ||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
28998018 |
gtcaggggcggatctactgtgaaacatggtgtggcagttgccacaccagat |
28998068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 213 - 267
Target Start/End: Original strand, 41969780 - 41969834
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattcccta |
267 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41969780 |
gggcggattcaccttgaaacatggtgtggcacttgccacaccagattattcccta |
41969834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 213 - 262
Target Start/End: Complemental strand, 42897802 - 42897753
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattatt |
262 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42897802 |
gggcggatccagtttgaaacatggtgtggcagttgccataccagattatt |
42897753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 213 - 248
Target Start/End: Complemental strand, 36617087 - 36617052
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgc |
248 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36617087 |
gggcggatccacagtgaaatatggtgtggcagttgc |
36617052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 265
Target Start/End: Original strand, 19815130 - 19815163
Alignment:
| Q |
232 |
catggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
19815130 |
catggtgtggcacttgccacaccagattattccc |
19815163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Original strand, 38663019 - 38663052
Alignment:
| Q |
226 |
gtgaaacatggtgtggcagttgccacaccagatt |
259 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
38663019 |
gtgaaacatggtgtggcagctgccacaccagatt |
38663052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 254
Target Start/End: Complemental strand, 46358056 - 46358015
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacacc |
254 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46358056 |
gggcggatccagtttgaaacatggtgtggcagttgccacacc |
46358015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 225 - 261
Target Start/End: Original strand, 46437321 - 46437357
Alignment:
| Q |
225 |
agtgaaacatggtgtggcagttgccacaccagattat |
261 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
46437321 |
agtgaaacatggtgtggcagctgccacacaagattat |
46437357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 227 - 255
Target Start/End: Complemental strand, 46458026 - 46457998
Alignment:
| Q |
227 |
tgaaacatggtgtggcagttgccacacca |
255 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46458026 |
tgaaacatggtgtggcagttgccacacca |
46457998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 213 - 265
Target Start/End: Complemental strand, 2123905 - 2123853
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2123905 |
gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
2123853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 213 - 265
Target Start/End: Original strand, 38740986 - 38741038
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38740986 |
gggcggatccacactgaaacatggtgtggcagttgccacaccagattattccc |
38741038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 213 - 262
Target Start/End: Original strand, 50158592 - 50158641
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattatt |
262 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50158592 |
gggcggatccacactgaaacatggtgtggcagttgccacaccagattatt |
50158641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 213 - 265
Target Start/End: Original strand, 33403427 - 33403479
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33403427 |
gggcggatctacactgaaacatggtgtggcagttgccacaccagattattccc |
33403479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 227 - 265
Target Start/End: Original strand, 32940712 - 32940750
Alignment:
| Q |
227 |
tgaaacatggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32940712 |
tgaaacatggtgtggcagttgccacaccagattattccc |
32940750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 258
Target Start/End: Original strand, 37187914 - 37187959
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagat |
258 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
37187914 |
gggcggatctactgtgaaacatggtgtggcagttgccacaccagat |
37187959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 225 - 264
Target Start/End: Complemental strand, 5458864 - 5458825
Alignment:
| Q |
225 |
agtgaaacatggtgtggcagttgccacaccagattattcc |
264 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5458864 |
agtgaaacatagtgtggcagttgccacaccagattattcc |
5458825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 217 - 262
Target Start/End: Original strand, 29702453 - 29702498
Alignment:
| Q |
217 |
ggatccacagtgaaacatggtgtggcagttgccacaccagattatt |
262 |
Q |
| |
|
||||||| | ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29702453 |
ggatccatattgaaacatggtgtggcacttgccacaccagattatt |
29702498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 259
Target Start/End: Complemental strand, 18431745 - 18431711
Alignment:
| Q |
225 |
agtgaaacatggtgtggcagttgccacaccagatt |
259 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
18431745 |
agtgaaacatggtgtggcagctgccacaccagatt |
18431711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 213 - 264
Target Start/End: Original strand, 34225679 - 34225730
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattcc |
264 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34225679 |
gggcggatccacactgaaacatggtgtggcagttgccacaccagattattcc |
34225730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 213 - 265
Target Start/End: Original strand, 25981138 - 25981190
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25981138 |
gggcggatccacactgaaacatggtgtggcagttgccacaccaaattattccc |
25981190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 219 - 266
Target Start/End: Original strand, 3058969 - 3059016
Alignment:
| Q |
219 |
atccacagtgaaacatggtgtggcagttgccacaccagattattccct |
266 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3058969 |
atccacactaaaacatggtgtggcagttgccacaccagattattccct |
3059016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 213 - 265
Target Start/End: Complemental strand, 14396152 - 14396094
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgt------ggcagttgccacaccagattattccc |
265 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14396152 |
gggcggatccacagtgaaacatggtgtggcaatggcagttgccacaccagattattccc |
14396094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 213 - 259
Target Start/End: Complemental strand, 18113880 - 18113834
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagatt |
259 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18113880 |
gggcggatgtacattgaaacatggtgtggcagttgccacaccagatt |
18113834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 214 - 262
Target Start/End: Original strand, 2197413 - 2197464
Alignment:
| Q |
214 |
ggcggatccacagtgaaacatggtgtggcagtt---gccacaccagattatt |
262 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2197413 |
ggcggatccaccgtgaaacatggtgtggcagttgccgccacaccagattatt |
2197464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 213 - 259
Target Start/End: Complemental strand, 424878 - 424832
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagatt |
259 |
Q |
| |
|
|||||||| ||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
424878 |
gggcggatgtacattgaaacatggtgtggcagctgccacaccagatt |
424832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 265
Target Start/End: Original strand, 39421044 - 39421077
Alignment:
| Q |
232 |
catggtgtggcagttgccacaccagattattccc |
265 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
39421044 |
catggtgtggcaattgccacaccagattattccc |
39421077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 213 - 266
Target Start/End: Complemental strand, 2918004 - 2917951
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattccct |
266 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2918004 |
gggcggattcacactgaaacatggtgtggcagttgccacaccagattattccct |
2917951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 213 - 262
Target Start/End: Complemental strand, 51513177 - 51513128
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattatt |
262 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51513177 |
gggcggatccactgtgaaacatggtgtggcagttgccacactagattatt |
51513128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 213 - 267
Target Start/End: Original strand, 28323076 - 28323130
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattcccta |
267 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28323076 |
gggcggattcaccttgaaacatggtgtggcacttgccacaccagattattcccta |
28323130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 213 - 267
Target Start/End: Complemental strand, 46672905 - 46672851
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgccacaccagattattcccta |
267 |
Q |
| |
|
|||| |||||||| ||||||||| || |||| |||||||||||||||||| |||| |
|
|
| T |
46672905 |
gggcagatccacactgaaacatgttgcggcacttgccacaccagattattaccta |
46672851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 250
Target Start/End: Original strand, 4939939 - 4939976
Alignment:
| Q |
213 |
gggcggatccacagtgaaacatggtgtggcagttgcca |
250 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4939939 |
gggcggatccactatgaaacatggtgtggcagttgcca |
4939976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 67 - 120
Target Start/End: Complemental strand, 28654834 - 28654781
Alignment:
| Q |
67 |
actctaaaatcaaaaattgggccttgactcagtatattttgatcttaaatattt |
120 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28654834 |
actctaaaacgaaaaattgggccttgactcagtatattttgatcttaaatattt |
28654781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 28668244 - 28668193
Alignment:
| Q |
1 |
ttggagaaaccatctatgtattttggtggaagagatgctgaacatgatgaac |
52 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
28668244 |
ttggagaaaccatctatatattttggtggaagagatgctgaacataatgaac |
28668193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 210 - 262
Target Start/End: Original strand, 37622828 - 37622880
Alignment:
| Q |
210 |
caagggcggatccacagtgaaacatggtgtggcagttgccacaccagattatt |
262 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
37622828 |
caagggcggatccacattgaaacatggtgtgacacttgccacaccagattatt |
37622880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 28676883 - 28676841
Alignment:
| Q |
1 |
ttggagaaaccatctatgtattttggtggaagagatgctgaaca |
44 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28676883 |
ttggagaaaccatctatgtattt-ggtggaagagatgctgaaca |
28676841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University