View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1353_low_14 (Length: 277)
Name: NF1353_low_14
Description: NF1353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1353_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 111 - 233
Target Start/End: Original strand, 43462111 - 43462233
Alignment:
| Q |
111 |
gttcaagatgaattttgaaacttaattgaccatttagtttctagtaatgttaattttaattttattatataatttttgtatgtgagtggtttggtgaaat |
210 |
Q |
| |
|
||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43462111 |
gttcaaggttaattttgaaacttaattgaccgtttagtttctagtaatgttaattttaattttattatataatttttgtatgtgagtggtttggtgaaat |
43462210 |
T |
|
| Q |
211 |
ttggttaagaatcttaattcatt |
233 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43462211 |
ttggttaagaatcttaattcatt |
43462233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 55 - 100
Target Start/End: Original strand, 43462015 - 43462060
Alignment:
| Q |
55 |
gaacaatcatcgaccttctcgtaagctaattataaatacttctatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43462015 |
gaacaatcatcgaccttctcgtaagctaattataaatacttctatt |
43462060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University