View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1353_low_18 (Length: 233)
Name: NF1353_low_18
Description: NF1353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1353_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 110 - 159
Target Start/End: Complemental strand, 1158563 - 1158514
Alignment:
| Q |
110 |
gaaaagaaagtagtatcagataaatggtctttgctacttcagcattatat |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1158563 |
gaaaagaaagtagtatcagataaatggtctttgctacttcagcattatat |
1158514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University