View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1353_low_22 (Length: 210)
Name: NF1353_low_22
Description: NF1353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1353_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 132
Target Start/End: Complemental strand, 6539273 - 6539142
Alignment:
| Q |
1 |
tgtaggttgcagttaagaaattgaagaatccagtggatgggttcttcataaaacataaggtacataatacaaatggaaattaacttaacagttgcagtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6539273 |
tgtaggttgcagttaagaaattgaagaatccattggatgggttcttcataaaacataaggtacataatacaaatggaaattaacttaacagttgcagtta |
6539174 |
T |
 |
| Q |
101 |
ggatgtatttttcataaaccatggggcgtaac |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6539173 |
ggatgtatttttcataaaccatggggcgtaac |
6539142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 54 - 120
Target Start/End: Original strand, 7174031 - 7174096
Alignment:
| Q |
54 |
cataaggtacataatacaaatggaaattaacttaacagttgcagttaggatgtatttttcataaacc |
120 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| ||||||| ||| ||||| || |||||||||| |
|
|
| T |
7174031 |
cataaggtacataacataaatggaaattaacttaa-agttgcaattatgatgtgttgttcataaacc |
7174096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University