View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1353_low_7 (Length: 406)
Name: NF1353_low_7
Description: NF1353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1353_low_7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 24 - 406
Target Start/End: Original strand, 38736663 - 38737045
Alignment:
| Q |
24 |
tcatcaagttcacaggtatgcttatgaatggggattggatagcaatacttcagttggaacagctcttattaatatgtactctaagtgcggggttctgtgt |
123 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38736663 |
tcatgaagttcacaggtatgcttatgaatggggattggatagcaatacttcagttggaacagctcttattaatatgtactctaagtgcggggttctgtgt |
38736762 |
T |
|
| Q |
124 |
gatgcgcgagttctttttgactcgaagttcgcgaattgtctggttaacgcgccttggaatgcaatgatcacgggttattcacaagctggttgtcaccttg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38736763 |
gatgcgcgagttctttttgactcgaagttcgcgaattgtctggttaacgcaccttggaatgcaatgatcacgggttattcacaagctggttgtcaccttg |
38736862 |
T |
|
| Q |
224 |
aagctttggaaatgttcacaagaatgtgccaaaacgatgtcaaaccagatctttacacattttgttgtgtgttcaactcaattgctgcttcgaagtgttt |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
38736863 |
aagctttggaaatgttcacaagaatgtgccaaaatgatgtcaaaccagatctttacacattttgttgtgtgttcaactcaattgctggtttgaagtgttt |
38736962 |
T |
|
| Q |
324 |
gaaatccttaaaggaggcgcatggggtggctctaaaatgtggattcgatgcgatggaaattagtgtattgaatgcccttgccg |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38736963 |
gaaatccttaaaggaggcgcatggggtggctctaaaatgtggattcgatgcgatggaaattagtgtattgaatgcccttgccg |
38737045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University