View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1353_low_8 (Length: 364)
Name: NF1353_low_8
Description: NF1353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1353_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 269
Target Start/End: Complemental strand, 6299555 - 6299304
Alignment:
| Q |
17 |
atggattcatcctagttagttacccaaaggacatgtacctaaataagaaaattggattttctgcagtcccctctctctggacctctgcaacacaaattag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6299555 |
atggattcatcctagttagttacccaaaggacatgtacctaaataagaaaattggattttctgcagtcccccctctctggacctctgcaacacaaattag |
6299456 |
T |
 |
| Q |
117 |
attcataaactgacaattcgcctgagcgttctgatcgggaccagcaattgctaaaggatcagtagcaaatctgttcggtgttcctaacaaaggtaaattt |
216 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6299455 |
attcataaactgacaattcacctgagtgttctaatcgggaccagcaattgctaaaggatcagtagcaaatctgttcggtgttcctaacaaaggtaaattt |
6299356 |
T |
 |
| Q |
217 |
gcttaaaaatgcatgtatcttttctgctcaatccaaataatagagtggatatt |
269 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6299355 |
gctt-aaaatgcatgtatcttttctgctcaatccaaataatagagtggatatt |
6299304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University